ashleytorrao4662 ashleytorrao4662
  • 02-09-2018
  • History
contestada

Who described politics as "who gets what, when, and how"?
a. james madison
b. abraham lincoln
c. harold lasswell
d. john locke
e. franklin roosevelt?

Respuesta :

Аноним Аноним
  • 02-09-2018
abraham lincoln American politics leader.he was rules at 1926 . He was elected U .S Senate
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What are some methods used by Mussolini to rise to power?
What are some methods used by Mussolini to rise to power?
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
Please help me with this two step math problem! THANK YOU !!!!!!!!
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
what is the percent change from 70 to 56?