laylahwisnewski laylahwisnewski

03-04-2020
Mathematics

contestada

the volume of an ice cream cone is 12 pi cubic cm. if the height is 9 cm, what is the diameter of the cone ?

Respuesta :

03-04-2020

Answer:

You didnt identify the volume so we can find the radius

Step-by-step explanation:

lol

Answer Link

Otras preguntas

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

At the end of the year, Mercy Cosmetics’ balance of Allowance for Uncollectible Accounts is $730 (debit) before adjustment. The balance of Accounts Receivable i

If the pound sterling appreciates against the U.S. dollar, England buys _____ U.S. goods, causing the U.S. aggregate demand curve to shift to the _____. more; l

150 increased by 40%

A die is rolled twice. What is the probability of showing a 1 on the first roll and an even number on the second roll? Durian

1. Consider a head-on collision between two identical billiard balls. Ball 1 is initially in motion toward ball 2, which is initially at rest. After the collisi

Goes through every edge exactly one; starts and stops at different places. a Hamiltonian Path b Hamiltonian Circuit c Euler Path d Euler Circuit

Simplify (3 + 6x) - 2(x+1) + 5 what's the answer?

what is judical settlement

Ellie is placing an order for 5 tuna salads and 2 chicken salads. Each salad costs $8.50, including tax. What is the total cost of the salads?