wakeup2saysrry wakeup2saysrry
  • 05-04-2020
  • Mathematics
contestada

I’m so slow at math so please help

Im so slow at math so please help class=

Respuesta :

07alexpm
07alexpm 07alexpm
  • 05-04-2020

Answer:

x=20. if trianngles are similar

Step-by-step explanation:

the side is 11 in one picture, and then 55 in the next., multiplied by 5.

4*5 is 20, and thus x=20

Answer Link

Otras preguntas

A string of lights contains three lights. the lights are wired in series, so that if any light fails the whole string will go dark. each light has probability .
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Why do you think it is a good idea to soak wilted lettuce in cool water before serving it?
Use the Internet to research current events on healthcare reform. How will proposed healthcare reform impact insurance practices in the pharmacy?
The learning curve describes the ________ relationship between ________ and ________
When a red blood cell is placed in hypotonic (very dilute) solutions of nacl?
what is r in this equation? πr^2=42π
Sam is eating a Big Hamburger. The first bite was 20% of the Hamburger, the second bite was 20% of what is left and so every next bite is 20% of what is left. a
what is the final product? ^5sqrt4x^2 ^5sqrt4x^2
Help! Exponential Equation WITHOUT CALCULATOR