laurajime016
laurajime016 laurajime016
  • 04-05-2020
  • English
contestada

Can somebody help me please???

Can somebody help me please class=

Respuesta :

Ruthie14
Ruthie14 Ruthie14
  • 12-05-2020

Answer:

Work it out yourself

Explanation:

Answer Link

Otras preguntas

Alice spent 6 minutes on each factoring problem and 3 minutes on each evaluation problem. she spent a total of 42 minutes on 9 problems. how many minutes did sh
Why did the United States go to war with Britain in 1812
help plz asap !!!!!!!!!!
What is skeletal connective tissue? Give its function
Find the length of a leg of an isosceles right triangle whose hypotenuse measures 8√2
What is true concerning an ecological community? it is a large region of multiple organisms the boundaries, large or small, of a single organism the ecosystem o
What law required Northerners to assist in the return of runaway slaves
Which of the following excerpts from Fast Food Nation best provides evidence that fast food restaurants are designed for using unskilled labor? Her family’s mo
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
If 2/3 + 6 = 7/6p, what is the value of p?