yazmene0203 yazmene0203
  • 01-03-2021
  • Mathematics
contestada

Which graph represents the inequality x>6

Respuesta :

houwaiyip499 houwaiyip499
  • 01-03-2021

Answer:

Step-by-step explanation:

Ver imagen houwaiyip499
Answer Link
joshydb2009
joshydb2009 joshydb2009
  • 04-05-2021

Answer:

D

Step-by-step explanation:

Ver imagen joshydb2009
Answer Link

Otras preguntas

Given the sequence in the table below, determine the sigma notation of the sum for term 4 through term 15. n an 1 4 2 −12 3 36
Why did new technology revolutionize communications
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Which of these describes an endothermic process? When lithium is placed in water, the temperature of the container increases. The combustion of kerosene re
-6.8 + (-12) + (-72.3).
How is the creation of public policy in Russia different from that in the United States?
What is the main reason night driving is more difficult than daytime driving?
Which statement describes a main difference between CPR performed on adults and CPR performed on infants? a) For adults only, alternate between compressions a
The_____ form acidic compounds with hydrogen.
Which factor controls the water cycle? A. Energy from the sun B. Changing ocean currents C. Volcanic eruptions D. Burning of fossil fuels