Carmelatrejo2009 Carmelatrejo2009

01-03-2021
Mathematics

contestada

Fifty tickets were sold for the lottery. Jackson bought five tickets. What are the chances he will win?

Respuesta :

faithgoldenis faithgoldenis

01-03-2021

Answer:

1/10 chances or 5/50.....

Answer Link

Otras preguntas

A wrench 0.500m long is applied to a nut with a force of 80.0N. Because of the cramped space, the force must be exerted upward and at an angle of 60.0 degrees,

How does the temperature of the sea, wind speeds and moisture in the air affect Hurricane Formation?

Explain how to find the product 3^5 x 3^2 using rules for exponents.

Write a do-while loop that continues to prompt a user to enter a number less than 100, until the entered number is actually less than 100. End each prompt with

Frank builds a triangle from three pieces of drinking straws. Which lengths of straw could he use? A 3 cm, 8 cm, 4 cm B. 10 cm, 5 cm, 6 cm c. 1 cm. 4 cm, 5 cm D

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

9. Simplify 1-3 - 81.

Mr. Inderhees wrote an equation and the first step of his solution process, as shown. 15 = −5 +4x 20 = 4x Which math operation did Mr. Inderhees apply in his

x-7>27 Sove the inequality and enter your solution as an inequality comparing the variable to a number

Describe the process of the selection of federal judges