lilybellgonzalez lilybellgonzalez

04-10-2021
Chemistry

contestada

What is the charge of the nickel ion in Ni(CIO3)3 if chlorate, ClO3-, has a charge of
1- ?*

Respuesta :

albertkwofie5000 albertkwofie5000

04-10-2021

Answer:

i am new but I haven't reached this level yet

Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

ACTIVITY 3 Directions: After identifying the persuasive points, in your notebook, write a summary of the text.

which type of bone growth occurs within cartilage and results in bone elongation?

Dan ran a total of 514 miles in 4586 minutes. What was the speed of his miles per hour

what is an analog computer?

Harriet earns the same amount of money each day. Her gross pay at the end of 7 workdays is 35h 56 dollars. Which expression represents her gross pay each day? 5

what are the five stages of change, and how are they useful to you?

Please help me, I don't know

Which answer matches this description? 45 divided by the sum of 6 and 3 (6 + 3) + 45 (45 - 6) + 3 (6 + 3) = 45 45 - (6 + 3)

A 75-year-old male is postexploratory laparotomy with a total gastrectomy for gastric cancer. He is postoperative day 2 and has developed a fever of 38.5°C (101