kobecase132
kobecase132 kobecase132
  • 04-05-2017
  • World Languages
contestada

t,f atom are smaller than electrons

Respuesta :

cashcash7
cashcash7 cashcash7
  • 04-05-2017
it is 1000000 times smaller than the electron cloud so true


Answer Link
Dawson14
Dawson14 Dawson14
  • 04-05-2017
The answer would be true because it is way smaller than electrons
Answer Link

Otras preguntas

(75) pointsPlease help me on these questions ASAP!!!
3∙(a+x), if a=8; x=−10
Regents what was a goal of progressive era reforms such as recall, referendum, and the direct primary?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Please help with geometry!!!
What is the lowest level of measurement that a median can be computed?
Alice spent 6 minutes on each factoring problem and 3 minutes on each evaluation problem. she spent a total of 42 minutes on 9 problems. how many minutes did sh
PLEASE HELP ME !!!!!!!!!! I BEG YOU !!!!!! PLEASE HAVE MERCY !!!!                           Use I = PRT to solve I = $350 P= $700           Find T (T
The chloroplast found within a photosynthetic protist is surrounded by four membranes. how can we account for this
When did the eastern part of the Roman Empire fall?