daiseemay2 daiseemay2
  • 02-06-2014
  • Mathematics
contestada

Solve the simultaneous equations
2x+3y=-3
3x-2y=28

Respuesta :

kate200468
kate200468 kate200468
  • 03-06-2014
[tex] \left \{ {\big{ 2x+3y=-3\ /\cdot2} \atop\big {3x-2y=28\ /\cdot3 }} \right.\\\\ \left \{ {\big{ 4x+6y=-6} \atop\big {9x-6y=84 }} \right.\\---------\\4x+9x=-6+84\\\\13x=78\ /:13\\\\x=6\\\\2x+3y=-3\ \ \ \ \Rightarrow\ \ \ 2\cdot6+3y=-3\ \ \ \Rightarrow\ \ \ 3y=-3-12\\\\3y=-15\ /:3\\\\c=-5\\\\Ans.\ \left \{ {{x=6} \atop {y=-5}} \right. [/tex]
Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Please help me with this one too !!!
__________ is a good example of congressional casework. analysis of an incumbent's policy positions prior to a debate analysis of water quality within a distric
What is the value of c?
The introduction of the Green Revolution in India was intended to
The cube root of the square root of the real number in is 16. what is the value of n.
Fractures of the blank of long bones are especially common in young animals
3∙(a+x), if a=8; x=−10
(8n+1)(6n-3) please solve in quadratic formula
From fourteenth-century germany, the artist ________ the organic forms of the bodies of mary and jesus in order to express pain and suffering.