Nyyankeezgrl19Cats Nyyankeezgrl19Cats
  • 01-11-2015
  • Chemistry
contestada

Element used to make first atomic bomb

Respuesta :

Narusin12
Narusin12 Narusin12
  • 01-11-2015
The element used to make the first atomic bomb is uranium
Answer Link

Otras preguntas

I need help with the entire page please help so I don’t fail
Help Pls and Fast. correct answer gets brainliest −8⋅f(0)+4⋅g(−8)
Those who did not want to break away from Britain were called .
What are the coordinates of Point X?
In "Señor Noboa," which two statements best describe Señor Noboa's response to the laborers' reaction to him? A. He resolves to persuade them that he is fair t
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
What is 1+1? Please HELP!!!! Will give brainliest
HELP!!! The town council votes to construct an energy plant on the bank of a large river. It uses river water in its cooling tanks and releases the wastewater b
Ai là người khởi nghĩa hai bà trưng
Higher atmospheric temperatures cause glaciers to melt more quickly. The melting of exposes new bedrock and ocean water absorb more energy from the sun than ice