mustafaserang8710 mustafaserang8710
  • 03-02-2018
  • Mathematics
contestada

Two plumbers were working together on a new apartment building. one of them was the father of the other one's son. how is this possible?

Respuesta :

Danielleyoung72 Danielleyoung72
  • 03-02-2018
it was the farther and son
Answer Link
purplebelle09 purplebelle09
  • 03-02-2018
Plumber #1 is a man and the husband of Plumber #2.
Therefore he works with his wife and they have a son.
Answer Link

Otras preguntas

Write one or two sentences about the main idea or purpose of the article.
Do you think social mobility is an easy thing to achieve in the US? Why or why not?
Multivitamin/mineral supplements should never be given to toddlers. a. True b. False
A number is increased by 50 percent, then the resulting number is decreased by 40 percent. What is the original number if the final number is eight less than th
Can someone Help me with that please
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The available farmland in Mali is in the northeast. True or false
stuck i need help please
What transportation technology made getting around in cities easier in the mid to late 1800s? A. Automobiles B. Cable cars C. Gondolas D. Hor
What are the different ways of interpreting the title of the short story was it a dream