natalierodriguovvs0j natalierodriguovvs0j

03-05-2018
Mathematics

contestada

Please help and explain thank you

Please help and explain thank you class=

Respuesta :

dvikhan dvikhan

03-05-2018

I think the answer would be 50 degrees because I know that 5x + 4x = 90 degrees. Using this information I started of simple by substituting x for 10. 5*10(BOC) + 4*10(BOA) = 90, so the measure of angle BOC would be 50 degrees. Hope this helps you!

Answer Link

Otras preguntas

When being dealt two cards from a standard deck of fifty-two playing cards, find the probability that both cards are an ace.

We know that 50.5 grams of sucrose is equal to 0.148 moles of sucrose, we need to use this information to find the molarity (the unit of measuring concentration

what is 14% of $3.40

2. Write the equation of the graph shown below. 3 1 -2 0 2 1-

If the side ratio is 4:17, the the area ratio is

the graph of each function is shown. write the function in factored format. do not include complex numbers

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

The Kenyan site of Olorgesailie is famous forO a nearly complete Homo erectus skeleton.O a concentration with thousands of hand axes, other tools, and butchered

Someone help how do I find if it’s a function

which is more resistance? fungi endosporesstaphylococccus bacteriatuberle bacilli